If the sequence of one strand of DNA is written as follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3' Write down the sequence of complementary strand in 5' → 3' direction
The DNA strands are complementary to every different with appreciate to base series. Hence, if the series of one strand of DNA is 5'- ATGCATGCATGCATGCATGCATGCATGC - 3' Then, the collection of complementary strand in course will be 3'- TACGTACGTACGTACGTACGTACGTACG - 5' Therefore, the series of nucleotides on DNA polypeptide in course is 5'- GCATGCATGCATGCATGCATGCATGCAT - 3'
